Достижения науки и техники АПК

Теоретический и научно-практический журнал

Поиск

Авторизация

Авторизация

2022_07_05_en

Biotechnological approaches in tomato breeding for resistance to Fusarium oxysporum f sp. Lycopersici

 

S. O. Korzh, E. V. Dubina
Federal Scientific Center of Rice Breeding, pos. Belozernyi, 3, Krasnodar, 350921, Russian Federation

Abstract. The studies aimed to assess the possibility of using modern biotechnological approaches for the selection of tomato genotypes with increased resistance to fusarium wilt. The methods of molecular marking of tomato hybrids for the presence of resistance genes to Fusarium oxysporum f sp. Lycopersici were studied and developed. The experiments were carried out under the conditions of the Krasnodar Territory. In 2021-2022 specific DNA primers for the selection of tomato plants linked to resistance to Fusarium oxysporum f sp. Lycopersici were analysed. As a result of approbation of 6 markers for further study of tomato plants for the presence of the Fusarium I-2 resistance gene, 2 informative loci I-2/5 (forvard: caaggaactgcgtctgtctg; reverse: atgagcaatttgtggccagt) and I2OH (forvard: tggagag-ttccctacacttgag; reverse: ttctcttcaaggtagttggcag) were selected. The marker systems TFus, FWZ-1063 and 11G071430 were not suitable for visualization of donor alleles of target genes. Analysis of sterile tomato samples of the F2 segregating population, as well as F2 breeding hybrid plants created by crossing the maternal form possessing a valuable morphotype with the paternal form (resistance donor) of tomato, by PCR using I-2/5 SSR marker and I2OH SCAR-marker, it was possible to isolate a specific resistance allele of the I-2 gene. 14 tomato breeding samples of the 52 analysed (control samples containing the I-2 gene were hybrid samples 7682-7/20 and 1042-1/14 (Gavrish) and F1 hybrid Zolotoj Potok (Poisk)) were isolated as they contained Fusarium wilt resistance gene. Samples represented by homozygous resistant forms were selected for further breeding work. The tested markers can be used for screening collections and searching for new sources of resistance genes to Fusarium oxysporum f sp. Lycopersici, and specimens carrying the Fusarium wilt resistance gene may later become sources of resistance to this disease.

Keywords: tomato (Solanum lycopersicum); breeding; Fusarium wilt; SSR markers; PCR.

Author Details: S. O. Korzh, junior research fellow (e-mail: S.O.Korzh@yandex.ru); E. V. Dubina, D. Sc. (Biol.), head of laboratory.

For citation: Korzh SO, Dubina EV. [Biotechnological approaches in tomato breeding for resistance to Fusarium oxysporum f sp. Lycopersici]. Dostizheniya nauki i tekhniki APK. 2022;36(7):31-5. Russian. doi: 10.53859/02352451_2022_36_7_31.